Your English writing platform
Discover LudwigSuggestions(5)
Exact(6)
(B) Phenotypes of RNAi mutant lines expressing OsPDS RNAi HpRNA construct.
In this study, we tried to detect the central functional domain(s) of GCS1, using complementation assay of ArabidopsisGCS1 mutant lines expressing modified GCS1.
Mutant lines expressing the VvMYB30 gene did not display significant differences in the aperture of the stomatal pores compared to atmyb60-1.
Upon infection with DC3000:: AvrRpt2, the three mutant lines expressing the coffee transgene were found to develop hypersensitive cell death symptoms that were absent in mutant plants.
Confocal laser microscopy of guard cells of slac1-1 mutant lines expressing SLAC1-WT-mVenus, SLAC1S59A-mVenus, SLAC1-S120A-mVenus or SLAC1-S59A/S120A-mVenus shows membrane-localized expression of all SLAC1 versions.
Consistently with results from the in vitro assay, mutant lines expressing the VvMYB30 gene did not show any difference in term of water loss compared to the atmyb60-1 mutant.
Similar(54)
All nrde-2 mutant lines expressed bright GFP from F3 onward.
Gene specific primers were: Oat-f: 5'agtcttggattaacttaggagag, Oat-r: 5'gtcccatatagttgagccattc for oat1 and oat2; Oat-f2: 5'gctttcatggacgtacattag, Oat-r2: 5'caagtatcaccatgtcaggac for oat3; the T-DNA left border specific primer was 5'ttcggaaccaccatcaaacag. None of the three mutant lines expressed clear kanamycin resistance.
We constructed a C. reinhardtii dyf13 mutant line expressing a GFP-tagged KAP subunit of the IFT kinesin-2, in a fla3 mutant background that lacks the endogenous KAP protein (Mueller et al., 2005).
The p53 mutant line expresses the full length p53 but has a mutation in the transactivation domain and cannot initiate p53-dependent transcription [ 35].
One mutant line expresses the G37R variant of hSOD1 from a vector that utilizes the mouse prion promoter (PrP.SOD1-G37R line 110, designated hereafter simply as G37R), which drives transgene expression primarily in muscle and neural tissue (20).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com