Sentence examples for mutant is underlined from inspiring English sources

LTR retrotransposon sequence insertion in the mutant is underlined.

The sequence of the mutant was found to be: CACTTTAGTTACAACATATTTATT The site of the mutation is underlined.

The nonsense mutation is underlined.

("Real" is underlined).

Cause-and-effect is underlined.

The word "am" is underlined.

Always is underlined three times.

(FLAG-tag is underlined).

The heterology is underlined in red.

The TAA (UAA) stop codon is underlined.

The restriction site NheI is underlined.