Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
No essential changes in doubling time were observed between strains carrying wild type or mutant ftsZ when grown on LB (Table 1).
Similar(59)
We showed previously that the mutant FtsZ L68W gave a 2.5-fold increase in trp fluorescence when assembly was induced by GTP.
For the Ga5DH deletion mutant, FtsZ was present in aberrant singlets or doublets, distributed along the length of the cell.
In vivo it was shown that expression of a mutant FtsZ that was predicted to stabilize the polymer could overcome the effects of MinCD overexpression [42].
The mutant ftsZ genes were amplified by PCR from chromosomal DNA from strains 3976, 3977 and 3979 using primers T3 (5'- AATTAACCCTCACTAAAGGG) and DJS161 (5'- CTGCAGGTCGACGGATCCCGGGAATAGATAGATAGTCATTCGGC).
Walled cells grow and divide normally in the presence of the antibiotic but the mutant FtsZ protein fails to support division in the absence of benzamide.
The T343A mutant of FtsZ was generated using pJB101 (Datta et al., 2002) as template and primers "a" and "d" (Table S2).
Indeed it has been shown that mutants in FtsZ that have slowed GTP hydrolysis kinetics also have a slower turnover rate inside the living cell [ 67].
When FtsZ was assembled in GMPCPP or in EDTA, the inhibition by SulA was reduced.
First, an FtsZ mutant that is defective in making lateral contacts in vitro does not support cell division [59].
We believe these structures are reminiscent of the previously reported extended helical structures when FtsZ is highly overexpressed [13].
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com