To determine whether Mst depletion differentially affects Tubulin and Actin in Drosophila, we analyzed levels of α- and β-Tubulin, γ-Tubulin, and Actin in wild-type and mst mutant extracts from either brains or whole larvae.
This was also confirmed in co-immuno-precipitation experiments where endogenous FYVE-CENT R1945Q mutant protein extracted from HCC-1954 breast cancer cells and Beclin 1 did not co-immuno-precipitate with an antibody against endogenous FYVE-CENT, whereas wild-type FYVE-CENT from a control cancer cell line was able to co-immuno-precipitate with Beclin 1 (Figure 2D).
As shown in Figure 2, the melting points of 100 pg of mutant DNA extracted from SW 480 colon carcinoma cells in the presence of 1 μg of wild-type DNA (1 : 10 000) were not detectable (curve 2 and 4).
Mutant PrP sequences were extracted from the mutant PrP plasmids described above using the primers 5′AAAAACTCGAGGCCCTCATCCCACGATCAGG3′ and 5′AAAAACTCGAGAGTCCAATTTAGGAGAGCCAAG3′, which contain XhoI restriction enzyme sites.
To compare protein expression profiles between WT and the spl5 mutant, total proteins extracted from fully developed leaves with lesions from spl5 and the corresponding leaves from WT were analyzed by 2-DE.
To test whether phyB is responsible for the reduction in CO protein early in the day in cop1 mutants, protein was extracted from phyB-9 cop1–6 and cop1 6 plants 6 and 16 h after dawn under SDs.
To assess expression of the ctu2 mutant alleles, mRNA was extracted from wild-type and the ctu2 mutant plants and RT-PCR was performed.
For analysis of REL2 cDNA sequence in rel2 mutant, total RNA was extracted from young leaves of WT and rel2 mutant respectively.
Total histones were extracted from mutant and wildtype larvae at 9 dpf and H3K27me3 was analyzed by western blot using specific anti-H3K27me3 anti-H3K27me27me2 antibodies.
RNAs were extracted from mutant embryos obtained from white seeds collected in developing siliques at 2 and 11 days after pollination.
