Sentence examples for mutant embryos using from inspiring English sources

For rescue experiments, the aldh1a2 ORF was amplified from TL embryos or aldh1a2um22 mutant embryos using FW: ATGACCTCCAGTGAAGTTGAACTGCCA and RV TTAAGACGTCTTGCTTCATCGTAATGGTTTTCA.

For RT-PCR, total mRNA was isolated from stage 16 wild type and γCOP mutant embryos using oligo dT -coupled beads (Dynabeads).

To distinguish between these two possibilities, we performed in situ hybridization of melanized 36 hpf and 48 hpf wild-type and enz mutant embryos, using the melanophore sublineage-specific riboprobes c-kit [7] and dct [23].

Phenotypic analyses were conducted with mutant embryos using littermates as controls.

To test this idea, we stained control and mutant embryos using rhodamine-conjugated phalloidin to detect F-actin.

However, as shown below, we can detect CEMs in unc-86 mutant embryos using a transcriptional egl-1 reporter.

To test whether this feature also applies to the cold phenotypes, we directed expression of a FLAG tagged form of Cold in the tracheal cells of a cold mutant embryo, using the btlGAL4 driver.

cDNA was generated from RNA of 72 hpf homozygous ste mutant and sibling embryos using oligo dT) primer and SuperScript III reverse transcriptase (Invitrogen).

However, crb transcript levels are markedly reduced in stat92E06346 mutant embryos generated using the germ-line clone technique [33] (Fig. 3F G).

We observed profound differences in staining between wild-type and homozygous mutant embryos when using anti-Nrg antibody (Fig. 8).

To test how the loss of nip affects DUOX function, we imaged H2O2 production in nip mutant embryos by using the Amplex Ultrared assay.