Sentence examples for mutant clones using from inspiring English sources

To test whether this effect is cell-autonomous, we induced delg homozygous mutant clones using the Flp/FRT system.

The fact that Abd-B was not detected in the double mutant clones using immunodetection (Figure 8F',G', arrows) demonstrated that the Abd-B RNAi construct efficiently disrupted Abd-B expression as desired.

These defects can be partially recovered by reexpressing Cp1 in mutant clones using a UAS-Cp1 trans-gene.

These defects can be partially recovered by reexpressing Cut in mutant clones using a UAS-cut transgene.

In an alternative approach, Ofut1 R 245 A was over-expressed in Ofut14 R 6 mutant clones using the mosaic analysis with a repressible cell marker (MARCM) technique [ 16], which employs the UAS-Gal4 system to drive expression under the control of a heterologous promoter.

In this report, we employed different genetic methods that allow for induced mitotic recombination using temporal or tissue-specific expression of the recombinase FLP [ 45] or allow for co-expression of other transgenes in the awd mutant clones using the mosaic analysis with a repressible cell marker (MARCM) system [ 46].

Later screens of individual TAS2R16 mutant clones used 4-nitrophenyl-β-D-glucopyranoside.

MARCM labeling of tra 1 mutant clones used y w hs-FLP UAS-mCD8-GFP / +; UAS-mCD8-GFP FRT G13 / +; tra 1 FRT 2A fru Gal4 / tubP-Gal80 FRT 2A flies.

MARCM labeling of fruM mutant clones used flies of the genotype: y w hs-FLP UAS-mCD8-GFP / (+ or Y); UAS-mCD8-GFP FRTG13 / FRTG13 tubP-GAL80; fruGal4 / fruM Prolonged incubation (2 3 days rotating at 4°C) with primary and secondary antibodies was required for homogeneous staining.

MARCM labeling of fruM mutant clones used flies of the genotype: y w hs-FLP UAS-mCD8-GFP / (+ or Y); UAS-mCD8-GFP FRTG13 / FRTG13 tubP-GAL80; fruGal4 / fruM Immunohistochemistry Prolonged incubation (2 3 days rotating at 4°C) with primary and secondary antibodies was required for homogeneous staining.

The primers: 5'actatccatggagtccatcttccacgagaaacaagaaggctcacttgctgctcaacattg (forward) and 5'atcttgcggccgcttacctaatcatctgcaggagttggtcagcttcgcaatctggcagatcacc (reverse) were used for a C14A Josephin mutant (cloned using NcoI and NotI restriction sites).