Suggestions(1)
Exact(5)
We illustrate the usefulness of our method by introducing three mutations into the bacterial Streptococcus thermophilus Cas9 (bStCas9) gene, converting the humanized S. thermophilus Cas9 (hStCas9) gene into nuclease dead or H847A nickase mutants and generating sunnyTALEN mutagenesis from a wild-type TALEN backbone.
By not considering homologous relatedness amongst the FP samples, a problem in which FPs are the products of site-directed mutagenesis from a few wild-type sequences may arise.
A PCR fragment was amplified by site-directed mutagenesis from a template pEYFP-hDMPK A plasmid with forward primer 5'- GGCCandTGTATGCCATGGCAATCATGAACAAGTGGGAC-3' and reverse primer 5'- GTCCCACTTGTTCATGATTGCCATGGCATACACCTGGCC -3' (mutation underlined).
The allele was generated by the so-called gap-repair mechanism via insertional mutagenesis from a pre-existing vector library, resulting in a duplication of a segment of the p63 gene and the retention of a Hprt minigene.
To define the functional significance of SNPs Ex1-1 (G/A), Ex1-2 (and) and Ex11-1 (C/T) on the expression of UGDH, we created plasmid constructs for the eight possible combinations (i.e., g-a-c, a-a-c, g-c-c, g-a-t, a-c-c, g-c-t, a-a-t, and a-c-t) by site-directed mutagenesis from a complete UGDH cDNA clone (g-a-c) and then transfected them into COS 7 cells.
Similar(55)
In fact, many of the FPs were obtained via site-directed mutagenesis from just a few wild-type sequences.
In particular, he notes that Charlotte Auerbach, in 1969, substantially changed our view of mutagenesis from being an aberrant chemical or physical (x-ray) damage to being a normal biological process.
In the present study, a novel herbicide (Imazethapyr) tolerant mutant resource was developed by EMS mutagenesis approach from a drought tolerant variety Nagina22.
While the natural forms of the HDV ribozymes appear to be prone to misfolding, biochemical and mutagenesis studies from a number of laboratories has allowed the production of trans-acting ribozymes and smaller more active cis-acting ribozymes, both of which will aid in further mechanistic and structural studies of this RNA.
An interesting example of potentially tissue-specific effects of mutagenesis came from a study of the impact of mismatch repair (MMR) defects on colon cancer.
We further validated our predictions with the natural PDZ domains by using a mutagenesis dataset from a domain specificity study [ 13] as described in the Materials and Methods section.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com