Sentence examples for murine podocytes using from inspiring English sources

Total RNA was prepared from cultured human or murine podocytes using the RNeasy®MiniKit (Qiagen, Hilden, Germany) following the protocol recommended by the manufacturer with an additional step of DNAse digestion (RNase-Free DNase Set; Qiagen).

Total RNA was prepared from human glomeruli and cultivated human or murine podocytes using the RNeasy®MiniKit (Qiagen, Hilden, Germany) following the protocol recommended by the manufacturer with an additional step of DNAse digestion (RNase-Free DNase Set; Qiagen).

Briefly, wildtype murine UCH-L1 was amplified by polymerase chain reaction from murine podocytes using the following primers: mUCHL1-pRetro-fw 5′CTAGGCGGCCGCGCCACCATGCAGCTGAAGCCGATGGA′3; mUCHL1-pRetro-rev 5′CTAGACGCGTTTAAGCTGCTTTGCAGAGAG′3 and subsequently cloned into the multiple cloning site of the pRetroX-Tight-Pur vector using NotI and MluI (ThermoFisher).

We examined GFP-tagged PINCH1 subcellular distribution in podocytes using microscopy.

We found larger than 90% blue cells using SAINT-PhD and about 80% of blue podocytes using Chariot (Figure 2).

In addition, we could confirm these results in PKCα+/+ and PKCα−/− podocytes using surface biotinylation before and after nephrin endocytosis.

Since it is desirable to profect normal and diseased podocytes in order to extend options for novel therapeutics we evaluated the potential of antibody uptake in podocytes using SAINT-PhD and IgG.

The D1ER plasmid was transiently transfected into podocytes using FuGENE HD.

To confirm that PDK1 protects podocytes against apoptosis, we knocked down PDK1 in cultured podocytes using two different lentiviral small-hairpin RNAs (shRNAs).

Total RNA was isolated from cultured podocytes using the RNeasy kit (Qiagen GmbH, Hilden, Germany).

Podocytes use a receptor mediated uptake mechanism to internalize IgG.