Suggestions(1)
Exact(2)
We further tested early signaling events upon TCR triggering in whole cell lysates by probing for tyrosine phosphorylation with immunoblotting (Fig. 5A and B) or multiplex analysis using a microbead suspension assay (Fig. 5C).
Supernatants harvested from cultures with cells isolated from WT mice were analyzed for IL-10 and interferon-gamma (IFN-γ) expression simultaneously by multiplex analysis using the Luminex 100 system (Becton Dickinson, Mountain View, CA).
Similar(58)
This method developed and enables a direct, simple, and quantitative multiplex protein analysis using conventional organic dyes and can be applied for disease diagnostics and detection of biological threats. 1.
Genotyping of the progeny was performed by multiplex PCR analysis using the human specific primer pairs: RCAN1-F primer, 5'- AGGACGTATGACAAGGACAT -3' and RCAN1-R primer, 5'-ATCAGAAACTGCTTGTCTGGA-3'; GdX-F primer, 5'- GGCandTGATCTCCAAAGTCCTGG-3' and GdX-R primer, 5'- AACGTTCGATGTCATCCAGTGTTA -3'.
Systemic cytokines/angiogenic factors will be evaluated and characterized in fasted blood prepared for multiplex assay analysis using Luminex 100/200 System (Luminex Corp, Austin, Tx) as previously described[ 39, 40].
Eleven RESTV-infected cynomolgus macaque serum samples were inactivated at 56°C for 30 min, diluted 1 10 in the assay diluent supplied with the Human Cytokine 25-Plex antibody bead kit (Invitrogen, CA), and were subjected to a multiplex cytokine analysis using a Luminex 100 instrument (Luminex Co., Austin, TX) according to the manufacturer's instructions.
Next, MLST analysis using multiplex PCR and NGS was performed for 48 strains of L. monocytogenes.
The present procedure using a single pair of primers for two fragments can overcome disadvantages in quantitative analysis using multiplex PCR.
Coding region analysis using multiplex amplified product-length polymorphisms revealed the incongruence of single nucleotide polymorphisms between the coding region and HVS 1 caused by contamination with exogenous mtDNA.
To investigate the effect of CEP-33779 on levels of pSTAT and cytokines in the paws of treated mice, a method was developed whereby synovial fluid and cellular joint extracts could be obtained from the paws and ankles of diseased animals for analysis using multiplex bead arrays [ 25].
Mice were bled at 3 hours for serum cytokine analysis using a multiplex bead assay, per the manufacturer's protocol using their software and hardware (Bio-Plex, Bio-Rad).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com