Sentence examples for multiple plants from from inspiring English sources

We survey diversity at 77 gene fragments sampled from multiple plants from each of six natural A. lyrata populations.

To do this, four different types of replicates were used: technical replicates running the same DNA on different genotyping runs; individual plants from the same seed source; individual plants from different seed sources; and pooled DNA from multiple plants from the same seed source.

For T1 seed analysis, seeds from multiple plants derived from each event were analysed.

Multiple plants regenerated from each selected transgenic line of calli were analysed for relative copy number according to the methods described by Basnayake et al. 2011 [ 18], with the exception of using a different GAPDH reference gene 3' primer (GAPDHrevb ACGGGATCTCCTCAGGGTTC).

Prior to the experiment, each aphid line was reared on multiple plants, chosen haphazardly, from a cohort of healthy plants of similar age and size for several generations in 16 L:8D intervals at 20°C in a Percival I-41LLVL environmental incubator to reduce effects resulting from variation in prior culturing (i.e. maternal and grandmaternal effects).

Soybean is highly inbred, but in order to minimize biological variation, RNA was extracted from approximately 10 to 30 seeds (depending on the stage) from multiple plants.

The increasing availability of genomic sequences from multiple plants is now permitting our first insights into this issue.

23 The identification of drought responsive USP genes from multiple plants species will present an array of research tools for genetic manipulation of plants for drought tolerance.

Total RNA was extracted from leaves and shoot meristem at the 4 5 leaf stage, prior to commencement of bulbing, from multiple plants of 'CUDH2150' and 'Nasik Red'.

According to the proposal, creating a single cohort with workers from multiple plants was crucial "to improve statistical power and the inferential value of the results" [ 29].

This more secure carbon source from multiple plants is important to the fitness of the fungal species in variable environments (Perry et al. 1989; Wilkinson 1998).