Sentence examples for multiple loci were from inspiring English sources

In order to examine genealogical concordance, multiple loci were examined.

Sequences for the multiple loci were amplified for each isolate using primers for the glpf, gmk, pta, tpi, ilvD, pur, and pycA loci as designed and described in that earlier study, with the exception of a new pta forward primer (ptaF1 5'- GCGTTTAGCAAAAGAAGAGTTAGTA -3') designed in this study.

Reads that aligned to multiple loci were discarded.

If multiple loci were available, these were concatenated.

The multiple loci were identified across all linkage groups, but they did not always map randomly.

Multiple loci were classified as Type I and Type II (Table S2).

Furthermore, inferences based on single genes could lead to erroneous conclusions and population genetic outcomes, thus usage of multiple loci is suggested.

Frequency distributions of the panicle blast severity in the three tested generations in different fields (Figure 3A, B, and C) suggested that multiple loci are involved in panicle blast resistance of Miyazakimochi.

The MLMM algorithm assumes that multiple loci are associated with resistance, and is a stepwise EMMAX, which re-computes genetic and error variance each step (Segura et al. 2012).

However, traits that are controlled by allelic series or multiple loci are not Mendelian characters, and are not subject to Mendelian ratios.

In the combined approach, sequences from multiple loci are concatenated, and the resulting data set is analyzed using phylogenetic methods.