Sentence examples for multiple identifiers from inspiring English sources

All generated amplicons were dual indexed with unique 5-mer multiple identifiers (MIDs) from both directions.

The generated amplicons were dual indexed with unique 5-mer multiple identifiers (MIDs) from both directions.

False-name bids are bids submitted by a single bidder using multiple identifiers such as multiple e-mail addresses.

Manual annotation of such a large number of metabolites, with multiple identifiers each, is extremely laborious.

SecureUDID creates multiple identifiers per device and a developer would need a domain and a salt to access them.

If multiple identifiers of different types map to the same output identifier, our confidence in that output identifier is increased.

association of a particular fragment with multiple identifier schemes.

Multiple Identifier (MID) Tags were used to combine ITS2 fragments from all individuals into a single 454 lane in a 16-lane sequencing run.

About 10 ng of DNA were used for amplification with primers specific for BRAF exon 15 (Fw 5′ – TGCTTGCTCTGATAGGAAAATGA – 3′; Rv 5′ – TGGATCCAGACAACTGTTCAAA – 3′) modified with universal tail sequences and multiple identifier (MID) nucleotides.

Users may search for their gene or function using a rich search syntax (Section 4) permitting entry of gene or protein synonyms from multiple identifier systems, and text-matching within gene or function descriptions (Fig. 1A).

If one source identifier can be mapped onto multiple target identifiers, all target identifiers can be saved as a list in the node table.