Sentence examples for multiple fragment amplification from inspiring English sources

Although intensive investigation into the optimal PCR conditions was not performed, amplification failure and multiple fragment amplification may be improved by controlling the annealing temperature or modifying the primer sequences for taxa of interest.

Amplification failure may be attributable to primer mismatch, large numbers of processed pseudogenes (Duvov and Perry 1984), and/or non-specific annealing, which may be responsible for multiple fragment amplification.

Samples that did not include at least 15 (70%) or more loci after multiple attempts at PCR fragment amplification were excluded from this study.

Samples that did not include six or more loci after multiple attempts at PCR fragment amplification were excluded from this study.

Fragment amplification was confirmed for at least three species for all primer pairs, and single fragment amplification was observed for at least one species in 16 primer pairs.

Single fragment amplification was observed for at least seven primer pairs per species.

Fragment amplification was performed under standard PCR conditions.

The following primers were used: AGCTACTGTAATGATCAGTCAACG (forward) and AGAGGTCCTTTTCACCAGCA (reverse) for 198 bp HPRT fragment amplification; GACCCGCCAACAAATTAAGA (forward) and TCGTGGTAAACTGGACACCA (reverse) for 215 bp STAT3 fragment amplification.

AGO1A-F and AGOMUT-R were for short fragment amplification, AGO1AMUT-F and AGO1A-R were for long fragment amplification.

The fragments were joined in a second PCR using the 5' primer from IL-2 fragment amplification and the 3' primer for IFNGR1 extracellular fragment first-round amplification.

Markers were assessed as multi-locus if multiple fragments were present after amplification with 'CUDH2150'CUDH2150