Sentence examples for multiple cloning sequence from inspiring English sources

A 44-bp fragment of the Cofilin 3'UTR containing the potential miR-103/107 Target Region was synthesized (Invitrogen) and inserted into the multiple cloning sequence of pMIR-Report (Ambion), downstream of luciferase (Fig. 4a, lower panel).

The first fragment included a multiple cloning sequence (MCS), a 5xGlycine linker, a V5-tag, and GFP sequence.

The primers used for PCR, GGGGTACC TGCACCCAATCCACACCCACTAAGA (forward) and CGGG ATCCACTGTCAAGGCGCAAATCCAGCAA (reverse), contain Kpn1 and BamH1 sites, respectively, which are compatible with the multiple cloning sequence in pGLII.

All constructs were made using the pGL3-Basic promoter backbone with inserts at the BglII and HindIII sites of the multiple cloning sequence.

The Brk cDNA was subcloned into the WKbpAII vector (a kind gift of Dr. Jeff Rosen, Baylor College of Medicine; [ 27]) using EcoR1 sites within the multiple cloning sequence.

All PCR products were cloned and multiple clone sequences determined.

An advantage of the great diversity of elements is that with a single PCR, cloning, and determination of multiple clone sequences one retrieves multiple independent sequences with which to do phylogenetic analysis.

Because all of the sequences presented here are consensus results, generated from multiple PCRs and multiple clones sequenced on both strands, the difference in the database for modern samples is best interpreted as a sequencing artifact in the published sequences.

Compared to single-pass ESTs or in silico assembled sequence contigs originating from multiple clones, sequence-verified FLcDNA clones offer several advantages for comparative, structural, and functional genome analyses, in particular for conifers with their great evolutionary distance from angiosperms.

In other words, each base of each sequence was covered by multiple PCRs and multiple clone sequences to determine the majority base for a given position as in Krings et al. [ 12].

However, the two primer pairs amplifying the 5S rDNA and kn1 gene fragments only amplified from both the B genome diploid of S. adhaerans and the B genome of allotetraploid of S. verticillata, but gave no amplification from the putative B genome in S. faberi, even though multiple PCR amplifications were tried and multiple clones sequenced.