Sentence examples for multiple clones with from inspiring English sources
Mutations also affect colony morphology, producing clonal sectors arising from a single mutation, and circular rings produced by independent mutations occurring in the same colony expansion phase which result in multiple clones with a similar phenotype ([14] and references therein).
The existence of multiple clones with genomic instability is one factor that renders ATL cells resistant to conventional chemotherapy.
However, 48 (92.3%) of the markers screened identified multiple clones, with 43 (90%) markers anchored to different contigs.
The presence of multiple clones with differing phenotypic characteristics within the primary can make identification and analysis of the metastatically competent cells very difficult.
The results indicate that this natural A. macleodii population has multiple clones with a potential for different phage susceptibility and exploitation of resources, within a seemingly unstructured habitat.
Because many RFLP groups contained multiple clones with the same restriction profiles, a single representative clone from each group was sequenced.
Tatiana Maslany stars in the series in a breakout performance as multiple clones, each with a distinct personality, often interacting with each other.
Why being infected with multiple clones is only associated with protection following clearance of parasites in this setting remains unclear.
The lists of genes were in general shorter than the original lists of clones both because multiple clones were associated with the same gene and because clones that could not be associated with any gene were present.
pK-A10 was made by cloning KJC-Adapter 10 [CTGAGATCTTAAGCTAGCAGGATCCAGAATTCATTCAG] into pK digested with PvuII creating a multiple cloning site with PvuII, BglII, AflII, NheI, BamHI, EcoRI, XmnI, and PvuII recognition sites.
The multiple cloning site with the polyadenylation addition sequence was removed with SpeI and BglII; this digested product was then ligated with the pminiTol2/MCS vector [49], which had been digested with the same enzymes, to create pMT/SV.
