Sentence examples for mouse primers provided from inspiring English sources

Exact(1)

Mouse primers provided by Applied Biosystems and Qiagen (Madrid, Spain) were previously validated (GAPDH, SIX2, PAX2, MMP9, WT1, WNT4, vimentin and megalin).

Similar(59)

Human and mouse U6 snRNA were amplified with primers provided from the QuantiMir RT Kit.

The new primers provide simple and efficient means to differentially diagnose H. hammondi from T. gondii even in samples containing both parasites, thus obviating the need for other labourious techniques like mouse bioassay and in vitro cultivation.

Genotyping of S89G-DMP1 mouse primers used for S89G point mutation identification: Dmp1-Neo-F-primer, CGCATTGTCTGAGTAGGTGTC; R-primer, GGTTCTTACATGGGCAGGATAAGC.

"Rather than being commensals," Dr. Dustin Penn of the University of Utah writes sternly in his "House Mouse Primer," "house mice are usually kleptoparasites, as they have been stealing our food stores since the agricultural revolution".

Primers for amplifying the SNP were designed using the Primer Premier 5.0 software, and the sequences of specific primers are provided in Additional file 2: Table S3.

Mouse tissue was provided to Celera by the Jackson Laboratory of Bar Harbor, Me., a leading mouse colony.

Specific mouse Gata4 E1andnd E1b cDNAs were generated by PCR and cloned into pGEM-T easy vector; the corresponding primers are provided in Table 1.

Beclin 1+/- mice were provided by Dr. Zhenyu Yue (Mount Sinai School of Medicine, The Rockefeller University, NY), and genotyped by PCR, using a forward primer (Neo: 5'- CGCCTTCTATCGCCTTCTTGACGAGTTCT-3') for Neo, a forward primer (BCNKOT-2R; 5'- GandTGGCTCCTGTGaGTATG-3'), and a reverse primer (BCNKOT-1C: 5'- TGGAGGGCAGTCCATACCCTGG-3') following Dr. Yue's protocol [20].

The list of primers is provided in Table 1.

PCR primers are provided in Additional file 1: Table S5.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: