Sentence examples for mouse primers provided from inspiring English sources

Mouse primers provided by Applied Biosystems and Qiagen (Madrid, Spain) were previously validated (GAPDH, SIX2, PAX2, MMP9, WT1, WNT4, vimentin and megalin).

Human and mouse U6 snRNA were amplified with primers provided from the QuantiMir RT Kit.

The new primers provide simple and efficient means to differentially diagnose H. hammondi from T. gondii even in samples containing both parasites, thus obviating the need for other labourious techniques like mouse bioassay and in vitro cultivation.

Genotyping of S89G-DMP1 mouse primers used for S89G point mutation identification: Dmp1-Neo-F-primer, CGCATTGTCTGAGTAGGTGTC; R-primer, GGTTCTTACATGGGCAGGATAAGC.

"Rather than being commensals," Dr. Dustin Penn of the University of Utah writes sternly in his "House Mouse Primer," "house mice are usually kleptoparasites, as they have been stealing our food stores since the agricultural revolution".

Primers for amplifying the SNP were designed using the Primer Premier 5.0 software, and the sequences of specific primers are provided in Additional file 2: Table S3.

Mouse tissue was provided to Celera by the Jackson Laboratory of Bar Harbor, Me., a leading mouse colony.

Specific mouse Gata4 E1andnd E1b cDNAs were generated by PCR and cloned into pGEM-T easy vector; the corresponding primers are provided in Table 1.

Beclin 1+/- mice were provided by Dr. Zhenyu Yue (Mount Sinai School of Medicine, The Rockefeller University, NY), and genotyped by PCR, using a forward primer (Neo: 5'- CGCCTTCTATCGCCTTCTTGACGAGTTCT-3') for Neo, a forward primer (BCNKOT-2R; 5'- GandTGGCTCCTGTGaGTATG-3'), and a reverse primer (BCNKOT-1C: 5'- TGGAGGGCAGTCCATACCCTGG-3') following Dr. Yue's protocol [20].

The list of primers is provided in Table 1.

PCR primers are provided in Additional file 1: Table S5.