Sentence examples for mouse lines we from inspiring English sources

Despite significant differences in infectious virus titers between the two mouse lines, we observed similar levels of inflammation and apoptosis in spleen and liver, although the two lines displayed distinct histopathology (figs. S4 to S6).

Despite significant differences in infectious virus titers between the two mouse lines, we observed similar levels of inflammation and apoptosis in the spleen and liver, although the two lines displayed distinct histopathology (figs. S4 to S6).

Using two photon time lapse microscopy of slices from multiple GFP+ mouse lines we did not find any evidence of motile stem or progenitor cells.

In vitro screening for mouse tumor cell lines revealed that all mouse lines we tested exhibited comparably low susceptibility to infection by our attenuated mutant virus, on par with normal quiescent human cells.

By using two independent mouse lines, we found that inducible knockout mice, lacking NMDA receptor in either forebrain or hippocampus CA1 region at the time of memory retrieval, exhibited normal recall of associative spatial reference memory regardless of whether retrievals took place under full-cue or partial-cue conditions.

Such analysis of the relationship between a daughter cell's "encounter histories" and its subsequent fate choice can be performed using the new transgenic mouse lines we describe here.

To generate a FLPo deleter mouse line, we injected the linearized PGK-FLPobpA fragment into pronuclei of fertilized eggs of the C57BL/6 mice.

To genotype the Rx-Cre mouse line, we used PCR primers MeRxgenoF (GTTGGGAGAATGCTCCGTAA) and MeRxgenoR (GTATCCCACAATTCCTTGCG) to amplify a 362 bp product detecting presence of cre sequences.

Based on the phenotypic characteristics of the mouse line we suggest that ARTE10 is a mouse model well suited for studying amyloid-lowering therapies and presumably also for validation of new target candidates.

After long-term breeding of the mouse line we indeed found three TgOvPrP4 mice subpopulations expressing in their brain ∼0.25, 1.5 or 6× the PrPc level measured in a sheep brain control.

While different subtypes of interneurons are labeled in this mouse line, we found a strong bias towards reelin-expressing, dendritically targeting interneurons with firing patterns showing delayed onset firing around threshold and moderate firing adaptation at higher firing frequencies.