Sentence examples for mouse line we from inspiring English sources

To generate a FLPo deleter mouse line, we injected the linearized PGK-FLPobpA fragment into pronuclei of fertilized eggs of the C57BL/6 mice.

To genotype the Rx-Cre mouse line, we used PCR primers MeRxgenoF (GTTGGGAGAATGCTCCGTAA) and MeRxgenoR (GTATCCCACAATTCCTTGCG) to amplify a 362 bp product detecting presence of cre sequences.

In order to elucidate the molecular mechanism of the transgene insertion in the mutant mouse line, we determined the chromosomal integration site of transgene by Southern blot analysis using the transgene as the probe (Tg_probe; Supplementary Information, Table S1).

While different subtypes of interneurons are labeled in this mouse line, we found a strong bias towards reelin-expressing, dendritically targeting interneurons with firing patterns showing delayed onset firing around threshold and moderate firing adaptation at higher firing frequencies.

Using a dmrt2 mutant mouse line, we show that this gene is not involved in symmetric somite formation and does not regulate the laterality pathway that controls left-right asymmetric organ positioning.

Based on the phenotypic characteristics of the mouse line we suggest that ARTE10 is a mouse model well suited for studying amyloid-lowering therapies and presumably also for validation of new target candidates.

To generate a series of inbred Akita mouse lines, we back-crossed the Ins2(C96Y) mutation more than six generations onto the 129/SvEv and DBA/2 backgrounds and compared the extent of hyperglycemia and renal disease with the standard C57BL/6-Ins2 C57BL/6-Ins2 +/C96Y

Despite significant differences in infectious virus titers between the two mouse lines, we observed similar levels of inflammation and apoptosis in spleen and liver, although the two lines displayed distinct histopathology (figs. S4 to S6).

Despite significant differences in infectious virus titers between the two mouse lines, we observed similar levels of inflammation and apoptosis in the spleen and liver, although the two lines displayed distinct histopathology (figs. S4 to S6).

Using two photon time lapse microscopy of slices from multiple GFP+ mouse lines we did not find any evidence of motile stem or progenitor cells.

In vitro screening for mouse tumor cell lines revealed that all mouse lines we tested exhibited comparably low susceptibility to infection by our attenuated mutant virus, on par with normal quiescent human cells.