Sentence examples for mouse genes using from inspiring English sources

Exact(12)

A preliminary analysis of the genomic regions around 20,000 mouse genes using this algorithm detected a marked enrichment of predicted regulatory peaks around TFs and other developmental regulators (data not shown).

Human genes were mapped to orthologous mouse genes using MGI mammalian orthology (http://www.informatics.jax.org/orthology.shtml).shtml

We obtained 15,630 one-to-one orthologous human and mouse genes using version 56 of Ensembl [ 24].

This database predicts mouse genes using orthologs to human annotation owing to the improved documentation of the 3′-untranslated region of human genes.

After mapping the human and mouse genes using the Homologene database (release 43.1), we displayed all usable arrays as points in a 3D principal component space.

Because NCBI Build 36 was used to map the mouse RP23-BAC clones, we mapped the genomic positions of the mouse genes using this older build.

Show more...

Similar(48)

The company found errors in data taken from mouse genes used to design one type of its gene chips, glass wafers with DNA fragments affixed to their surfaces.

Primer sequences for mouse genes used in this study are shown in Additional file 1: Table S1.

All mouse genes used in the co-expression network analysis are spelled according to the Mouse Genome Informatics (MGI) data base.

The C5 proteasome mRNA was obtained from the mouse gene using the primer pairs: 5′-TCAACGGAGGTACTGTATTGG-3′ and 5′-GCATGGCACTTGCTGAGCC-3′ at positions 101 121 and 496 514 bp.

The C2 competitor was obtained from the mouse gene using the primer pairs: 5′CGCACGGAGTGCTGGTTGCAC3′ and 5′GTACGA GCTGatTGAGAACGG–CATAACCAGCAATGAGCAGCC3′ at positions 176 187 and 531 552 bp to 435 455 bp, respectively, which produced a DNA fragment containing a 76-bp deletion.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: