Your English writing platform
Discover LudwigSuggestions(2)
Exact(12)
Genomic 129sv/svj mouse DNA was used for PCR-amplification of DNA sequences flanking exon 11 of Trpml3 (Fig. 1).
Mouse DNA was obtained from mice 3 weeks post delivery and digested with EcoRI for proof of αMHC-VgBmEcR-, and HindIII/BamHI for Ind-β2a -genomic integration.
Amplification of the CAG repeat from R6/2 mouse DNA was performed with a FAM labelled forward primer (GAGTCCCTCAAGTCCTTCCAGCA) and reverse primer (GCCCAAACTCACGGTCGGT) in 10 µl reactions containing: 0.2 mM dNTPs; 10% DMSO; AM buffer (67 mM Tris-HCL pH 8.8; 16.6 mM (NH4 S04; 2 mM MgCl2; 0.17 mg/ml BSA) and 0.5U AmpliTaq DNA polymerase (Applied Biosystems).
Amplification of the CAG repeat from R6/2 mouse DNA was performed with a FAM labelled forward primer (GAGTCCCTCAAGTCCTTCCAGCA) and reverse primer (GCCCAAACTCACGGTCGGT) in 10 µl reactions containing: 0.2 mM dNTPs; 10% DMSO; AM buffer (67 mM TrisHCL pH 8.8; 16.6 mM (NH4 S04; 2 mM MgCl2; 0.17 mg/ml BSA) and 0.5 U AmpliTaq DNA polymerase (Applied Biosystems).
Mouse DNA was used as the positive control.
Mouse DNA was extracted from tail biopsies of each individual after digestion in lysis buffer using standard phenol/chloroform extraction.
Similar(48)
Although mouse DNA is every bit as hard to decipher as human DNA, and just as important in finding genes to combat disease, there was no brouhaha today when Celera Genomics of Rockville, Maryland, announced that it has sequenced and assembled the entire mouse genome.
However, the observed differences in mouse DNA content between purification methods strongly suggest that mouse DNA is sample derived.
Yellowtail DNA and a mixture of yellowtail and mouse DNA were used as two independent positive controls.
We are thus rather sure that neither goat or whale nor traces of human, monkey or mouse DNA are present in the sample.
Assuming that free mouse DNA is responsible for the presence of mouse reads in the purified metagenomes, this would suggest that free DNA was not completely removed by DNase digestion.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com