Sentence examples for mouse dna using from inspiring English sources

Exact(6)

Southern blotting of fetal mouse DNA using flanking probes confirmed the deletion of exons 2 5 (Figure 1B).

The obtained reads were mapped to human and mouse DNA using the hg19 and mm9 assemblies, respectively, analysed and visualized as described previously.

The efficiency of each assay was verified with a standard curve starting from 100 ng of mouse DNA, using four serial dilutions from 1 1 to 1 8.

Using the protocol optimized as above, we prepared indexed TMS libraries from 3,000 to 10 ng of human and mouse DNA using the human and mouse RNA probe sets obtained from Agilent, respectively (Table  1).

The B. burgdorferi standard curve was generated in the presence of a constant amount of mouse DNA, using DNA isolated from B. burgdorferi grown in culture and mouse LA-4 cells (ATCC #CCL 196) or uninfected mouse livers using the same kit.

Average telomere length was measured from mouse DNA using a previously described monochrome multiplex qPCR (MMQPCR) method [ 64] with the following conditions: denaturation at 95°C for 15 min followed by 2 cycles of 15 s at 94°C and 60 s at 49°C, 4 cycles of 15 s at 94°C and 30 s at 59°C, 20 cycles of 15 s at 85°C and 30 s at 59°C, and 27 cycles of 15 s at 94°C, 10 s at 84°C, and 15 s at 85°C.

Similar(54)

The mouse CC10 promoter was cloned from the mouse genomic DNA using primers: 5'-TTGCAGGGAGTAAGGAGGGTCATGGGA-3' and 5'-GGCTTTGGTGTCTGTAGATGTGGGGTG-3'.

The constant region of the mouse immunoglobulin G1 (isotypesotype was amplified from mouse genomic DNA using primers 49 and 50, and inserted between the AscI and XbaI restriction sites for expression of the recombinant heavy chain.

Briefly, Mouse U6 promoter was amplified by PCR from mouse genomic DNA using the following oligos: sense: 5' GGAAGATCTATCCGACGCCGCCATCTCTA and antisense: 5' GTGGAATTCGTTAAC GAAGACCACAAACAAGGCTTTTCTCCAA.

Mouse clusterin promoter fragment (−1855 to +169) was amplified from mouse genomic DNA using TaKaRa LA Taq, inserted into the pGL3-Basic luciferase reporter vector (Promega, San Luis Obispo, CA) and the following primers used for PCR: forward 5' GGG GTA CCA CAT TCC TCC AAG TTT CTG 3', and reverse 5' CGG GAT CCA TGG GCT CTA GTC ACC TC 3'.

The mouse 3050-bp Tubb3 promoter was cloned by PCR from C57BL/6J mouse genomic DNA using the following primer sets: forward, 5′-GTTATTAATGTCGACAGGATGAGCTTTAAAATAG-3′ reverse, 5′-GAAGATCTGCTGACTTCACGCGGCTAGAGACGA-3′ (the AseI and BglII restriction sites were added for cloning).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: