Your English writing platform
Discover LudwigSuggestions(3)
Exact(1)
Beef, well-marbled and on the bone, is one of the most cited sources for stock-making, but pork stocks seem to have the most variations, with versions made of anything from simple fresh cuts to smoked ribs, ham hocks, and sausages in Hungary and Poland to crunchy pork ears in Ukraine.
Similar(59)
The plunge pool showed the most variation, with bed levels fluctuating by over 1 m.
Mo showed the most variation with 44 significant pairwise differences between accessions (Table S1).
Nursing programs reported the most variation with a minimum of less than one hour and a maximum of 52 hours.
98.3% of piRNAs mapping to the Ae. aegypti tj gene contain U in their first position while 75.3% commenced with the 25 nt sequence 5' UAUUGACAACAGAAGUAACGAAUGA 3' with most variations being in the small number of additional ribonucleotides present at the 3' end.
Increasing the flow rate reduced the borehole thermal resistance by up to 35%, with most variations when flow in the outer annulus changes from laminar to turbulent (Figure 2a).
Catalytic reagents have been less successful, with most variations suffering from poor yield, poor enantioselectivity, or both.
As with most variations calling that used resequencing data, we did not correct the sequencing errors of the raw sequencing reads; instead, we excluded the low-quality reads, sorted the mapping data and directly calculated the mapping ratio.
You can do this with most variations of a Canadian map.
Our results show an RMSD of 2.4 Å for E2 ectodomain and 2.9 Å for E1 ectodomain, with the most variations mapped to the E1 fusion loop region (Supplementary Figure S3).
Among them, the most explicit variations with the mark T are observed at the southern stations Tsumeb (19°S), Potchefstroom (27°S), and Hermanus (34°S).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com