Sentence examples for most variations are from inspiring English sources

Exact(1)

Shortbread cookies are wonderful in their unadulterated state, but you can flavor them in many different ways, and most variations are pretty easy.

Similar(58)

Most variations were labeled reciprocally, including AD, AA, ATE, RI, and SE.

The heterogeneity across the trials was low (I²=0.0%, p=0.891), indicating that most variations were incidental (figure 3).

Moreover, the observations were confounded by smoking because most variations were observed in non-smoking welders exposed to welding fume.

Most variations were missense and were located at classical hotspot codons, except for one specific mutation at codon 259 (p.D259N) that was found in six samples.

98.3% of piRNAs mapping to the Ae. aegypti tj gene contain U in their first position while 75.3% commenced with the 25 nt sequence 5' UAUUGACAACAGAAGUAACGAAUGA 3' with most variations being in the small number of additional ribonucleotides present at the 3' end.

In all of the studies so far, most variations were reported in the clarithromycin susceptibility results within different NTM species even with strains precisely identified and even with reference strains [ 5, 15, 16].

However, absolute constraints appear rare (Houle 2010), and the dimensions of the G-matrix with the most variation are likely those with the greatest effect on evolution in natural populations (Schluter 1996; Kirkpatrick 2009).

The spatial variation of biomass components was quite large, and most variation was observed between Mexican states.

X-ray crystallography and sequence analysis together reveal the hypervariable regions of hexon at the top of the molecule where the most variation is tolerated.

Eigenvector mapping and variation partitioning revealed that spatially independent habitat processes accounted for little of the variation in community composition (2.0%); most variation was attributed either to habitats that were spatially structured (25.6%) or to dispersal independent of habitat (28.0%).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: