For most of the PCSs, in particular those encoding putative phage particle proteins, the annotation was based on that of pZL12 [ 38], a well characterised plasmid with high levels of homology and synteny to pSLE1.
However, decreased expression of cg1551 encoding putative universal stress protein UspA is in line with faster growth of C. glutamicum in the presence of D-galacturonate.
Coincidently, Li et al. also reported that a gene locus of Aa encoding putative invasion-related protein is homologous to Yersinia enterocolitica YadA [31].
For amplification of gDNA or cDNA encoding putative bvrR and bvrS, the following primers were used: for Oant_0827 (bvrS): oantbvrS.3 GCATTCTCTACATGAATCAGTTCC and oantbvrS.5 GTGATGGCGTCAGGCTTTG.
Interestingly, polyG tracts were found elsewhere in the genome of 5632, again at the 5' end of gene encoding putative surface protein.
Three ORFs (orf2, orf3 and orf4) were found encoding putative transposases in the vicinity of rep165 (Fig. 5).
Putative transcripts that remain unannotated at the time of writing include those encoding putative methyltransferase and P450 domains, as well as numerous DDE domains often associated with transposons.
So far, 11 potential open reading frames (ORF) have been identified in the genome of PCV2 [ 14] with six ORFs encoding putative proteins larger than 6 kDa.
A total of 147 ORFs, with no or minimal overlap and encoding putative proteins of more than 50 amino acid residues, were identified.
We found that 16 out of top 30 most abundant ESTs encoded putative ribosomal proteins, indicating that RP-encoding ESTs are enriched in the topmost expressed ESTs compared to background (i.e., 53.3% versus 1.29%, p-value < 1.33E-07) in actively growing B. sudeticus cells (Table 1).
