Sentence examples for most common shared from inspiring English sources

Currently, images are among the most common shared types of data found on cloud storages, and they are a good candidate for deduplication.

Although Bolivia has 35 officially recognized languages (Taylor 2004), Spanish is the traditional language of the elite class and also the most common shared language between groups.

Unlike the second generation, whose most common shared experience is that of belatedness perhaps best summed up in the French writer Henri Raczymow's rueful statement, "We cannot even say that we were almost deported" (1986, 104)—the 1.5 generation's shared experience is that of premature bewilderment and helplessness.

The most common shared target is VEGF.

The most common shared MLG consisted of 18 biotype 2 individuals from the Df site.

The next most common shared location was a homeless shelter frequented by seven different homeless persons; none shared matching M. tuberculosis isolates.

Of the four, NimbleGen and Agilent technologies have the most in common, sharing almost 40 Mb of targeted sequences.

He delineated three primary characteristics, which are the most common features shared by destructive cults.

PH01 was the most common haplotype shared among the Alishan, Central, and Sheishan Mountain Ranges.

Sequences of specific primers to the most common haplotype shared by A. obtectus and A. obvelatus are: TTGATAACGCAACCTTAACC (forward primer) and GATTAGCAGGAATGAAGTTG (reverse primer).

H09 was the most common haplotype shared by 19 individuals and A. ruthenus♀ × H. dauricus♂ (XiH) had the biggest number of haplotypes (Table  2).