Sentence examples for more conserved dna from inspiring English sources

Exact(2)

Second, the phylogenetic position of the different ITS haplotypes was determined by using more conserved DNA regions and including an outgroup.

To estimate a rooted phylogeny, we sequenced two more conserved DNA regions for each ITS haplotype: Ca. 530 nucleotides of the nuclear 25S rDNA gene using the primers 25S4R (acaagtgctgagttcctcag; which is specific for Termitomyces; [ 9]) and ITS4R (GCATATCAATAAGCGGAGGA: the reverse complement of the universal primer ITS4; [ 36]).

Similar(58)

These findings suggest that for fungi, either group I introns tend to target conserved DNA sites more frequently, or group I introns survive in conserved sites for longer periods of time, while group II intron targeting is not strongly influenced by site conservation.

Four other proteins are slightly less similar (e.g., 25%and46%6% in identity and similarity for Ccel_2999; 26% and 44% for Ccel_3000) to CcpA but more conserved in DNA-binding helix-turn-helix (HTH) domains.

-, Either way, in contrast to the epigenetic reprogramming in PGCs, reprogramming in preimplantation embryos is more selective, conserving DNA methylation at ICRs and thus allowing the inheritance of the parental imprints by the new embryo (Fig. 2).

More fundamentally, the evolution of hypervariable core sequences within very highly conserved DNA sequence backgrounds has not been examined.

Liu, X., Brutlag, D. & Liu, J. BioProspector: discovering conserved DNA motifs in upstream regulatory regions of co-expressed genes.

WRKY genes contain one or two highly conserved DNA binding domains interrupted by an intron.

This process is accomplished through the concerted actions of highly conserved DNA replication components.

The members of the ETS family of transcription factors are grouped because they share a highly conserved DNA binding domain.

Shared SOG enhancer conserved DNA elements (5-->3').

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: