Your English writing platform
Discover LudwigSimilar(60)
Six rhesus monkey allel-specific primer pairs were designed based on published Mamu-A locus gene sequences.
Twenty nine cynomolgus monkey allele-specific primer pairs were designed based on published Macaca fascicularis (Mafa -DRB locus gene sequences.
An 834 bp transcript was cloned from peripheral blood mononuclear cells (PBMCs) of rhesus monkey using specific primers designed according to the predicted sequence of M. mulatta CD40 (mmCD40) in GenBank.
An isoform (rhesus UGT1A01) orthologus to the human UGT1A1 was cloned and sequenced from female rhesus monkey liver cDNA using primers designed from the human nucleotide sequences.
For rhesus monkey and human p62, primers were CAGTCCCTACAGATGCCAGA and TCTGGGAGAGGGACTCAATC, the double-labeled probe was TCCCAGGAGGGACCCACAGG.
For cloning of this potential cDNA, RT-PCR was performed with liver total RNA of rhesus monkey (mm35) using the primers that were designed to amplify the putative open reading frame (ORF), which led to the successful identification of the cDNA for this novel CYP2C named CYP2C93 (Fig. 1A).
A 1.4 kb segment of DAZ 3' UTR as well as the corresponding region in DAZL were PCR amplified from rhesus monkey genomic DNA using primers F-catgggaagttgctgcttttg and R-gttttagggatgaagccactg, cloned in the vector pCRII-TOPO (Invitrogen, Carlsbad, CA, USA) and sequenced.
The multiplex assay shows specificity for vervet DNA within the determined allele range for vervet monkeys; however, the primers will also amplify human DNA for each marker resulting in amplicons outside the vervet allele range in several of the loci.
For the amplification of envR(b) from chimpanzee, gorilla, orangutan, gibbon, Rhesus macaque (Old World Monkey) and Callithrix jacchus (New World Monkey) the forward T7 promoter-containing primer was GCTAATACGACTCACTATAGGAACAGACCACCATGGATCCACTACACACGATTGA and the reverse flanking primer was TGTTTTGGGACACCACGAAT.
To determine the genomic location of CYP2C93, PCR was performed using gene-specific primers with the rhesus monkey CYP2C BAC clones as templates.
Because these primers were unable to amplify this region in squirrel monkey, tamarin, gibbon, or galago, we amplified these species with alternative primer sets.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com