Biotinylated quantum dots are used as a label to monitor target analyte binding to the bead's surface.
The executive order creates sanctions against the government of Syria and Iran "and those who abet them, for using technologies to monitor, target and track its citizens for violence".
In addition to the target and drive system, the chamber is extensively instrumented in order to monitor target performance and deterioration.
The bacteria identification array was proven to be useful as an alternative method to detect and monitor target bacteria populations during food fermentation.
Monocytes are known to express VEGFR1, KIT, and PDGFR and, thus, may reflect a valuable tool to monitor target inhibition.
In summary, our results confirm that CSF Aβ1-34 may be useful in clinical trials on BACE1 inhibitors to monitor target engagement.
Samples were spiked with three synthetic pre-labelling control RNAs (3 fmol per sample; pCAGUCAGUCAGUCAGUCAGUCAG, pGACCUCCAUGUAAACGUACAA, and pUUGCAGAUAACUGGUACAAG; Dharmacon, Chicago, IL, USA) to monitor target preparation efficiency.
We have thoroughly validated this approach by monitoring target gene expression and regulator protein levels in the engineered strains and in the parent strain throughout growth (see below).
Periodic amyloid PET or CSF Aβ42 testing will be conducted to monitor target engagement and amyloid accumulation over the courses of the trials.
However, both agencies also have intelligence-gathering responsibilities under which they exploit vulnerabilities in technology to monitor targets.
