twitter.com/coreykilgannon… — Corey Kilgannon (@coreykilgannon) October 29 , 2012— COREY KILGANNON President Obama on Monday canceled an appearance at a rally in Florida to rush back to Washington to monitor preparations for Hurricane Sandy.
The diplomats, including the American ambassador to the United Nations, Susan E. Rice, had earlier toured southern Sudan to monitor preparations for the voting, which many analysts fear could reignite a north-south civil war if it is mishandled.
The White House announced that President Obama would fly back to Washington on Monday after a campaign event in Ohio in order to monitor preparations for and response to the storm.
After North Korea fired a multistage rocket on Monday, defense and intelligence officials said they had closely monitored preparations for the launch.
The administration's announcement was made after senior officials from the Treasury and the Federal Reserve spent Saturday and Sunday closely monitoring preparations by Freddie Mac to raise money to help meet its short-term financing needs.
An internal control targeting a bovine actin gene was also included in the same reaction tube to monitor RNA preparation and RT-PCR procedure.
UV vis spectrophotometry is employed to monitor the preparation process and the results indicate that Pt Sn complex formed once the precursors of Pt and Sn were mixed together.
We conclude that a health official should monitor food preparation and service at large social gatherings and that person-to-person transmission of salmonellosis probably does not normally occur even in settings considered highly conductive to cross-infection.
Fourier transform infrared (FTIR, Nicolet 560, Nicolet Instruments, Inc., Madison, WI, USA) and UV vis (Shimadzu UV-2100, Shimadzu Corporation, Kyoto, Japan) spectrometers have been used to monitor the preparation process of the nanoparticles.
Samples were spiked with three synthetic pre-labelling control RNAs (3 fmol per sample; pCAGUCAGUCAGUCAGUCAGUCAG, pGACCUCCAUGUAAACGUACAA, and pUUGCAGAUAACUGGUACAAG; Dharmacon, Chicago, IL, USA) to monitor target preparation efficiency.
It has been shown recently that TLC can be used to determine the size and purity of GAG-derived oligosaccharides, to analyze the activities of polysaccharide lyases acting on GAGs, and to monitor the preparation of GAG-derived oligosaccharides [ 51].
