Exact(3)
It can be used as an added tool for power quality (PQ) engineers and can be integrated into monitor instruments.
He's been trained in self-hypnosis, allowing "the body to regenerate into a very deep relaxation and keep the brain alert enough" to monitor instruments when awake, it's claimed.
These and many other questions imply that different types of monitor instruments will be needed for different categories of diseases.
Similar(57)
solar EUV monitor instrument.
The Akebono satellite carried a radiation monitor instrument, RDM, on board, and measured energetic electrons and protons.
The nucleotide GCATCCTGGAAAGCTACCTT, M– = 6366.1, at 0.6 μM was used to monitor instrument performance.
Normal human lymphocytes were used to monitor instrument performance and calibrate measurements of cellular DNA content.
Normal human lymphocytes were used to monitor instrument performance and to calibrate measurements of DNA ploidy.
Daily quality controls and standard plasma obtained from NIST were used to monitor instrument performance over the length of the data acquisition.
"Near the entrance, the soil was disturbed to lay cables for the monitoring instruments".
Dr. Münchow will travel to the region to retrieve monitoring instruments installed in 2009 in the Nares Strait between Greenland and Canada.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com