Your English writing platform
Discover LudwigSuggestions(2)
Exact(8)
solar EUV monitor instrument.
The Akebono satellite carried a radiation monitor instrument, RDM, on board, and measured energetic electrons and protons.
Normal human lymphocytes were used to monitor instrument performance and calibrate measurements of cellular DNA content.
Normal human lymphocytes were used to monitor instrument performance and to calibrate measurements of DNA ploidy.
The nucleotide GCATCCTGGAAAGCTACCTT, M– = 6366.1, at 0.6 μM was used to monitor instrument performance.
Daily quality controls and standard plasma obtained from NIST were used to monitor instrument performance over the length of the data acquisition.
Similar(52)
It can be used as an added tool for power quality (PQ) engineers and can be integrated into monitor instruments.
These and many other questions imply that different types of monitor instruments will be needed for different categories of diseases.
On 2 October, Nasa's ozone monitoring instrument observed this record-size hole in the ozone layer, spanning 28.2m sq km (10.9m sq miles) — the fourth-largest area measured since the start of the satellite record in 1979.
The spacecraft's ozone monitoring instrument, which also measures trace gases and pollutants important to air quality, will help scientists determine if there is any mixing between the "good" ozone in the stratosphere and the pollution variety nearer the ground.
The target would eventually be a flask filled with human tissue, but for now was a monitoring instrument that captured an image the way an X-ray film would.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com