Your English writing platform
Discover LudwigExact(1)
Read trimming, quality filtering, mapping, and conversion to per-gene counts was performed as described previously [ 27] with one modification: reads mapping to the same starting coordinate in the reference and aligning with 100% identity along the full length of the shorter read were discarded as potential PCR duplicates.
Similar(59)
Our studies support the general view that histone modification "reading" and DNA methylation are closely coupled in mammalian cells, and suggest an avenue for the functional assessment of chromatin-associated proteins.
We did not observe significant 5' modifications from reads derived from miRNAs in either cells or exosomes.
The choice of the cell viability assay using crystal violet staining was based on a previous work [ 32] with modification of reading A595 nm.
Note that this modification may produce reads shorter than l μ /4 if l(t i )< l μ /4, however this only occurred for 732 reads over all simulations (668 of which were for the l μ =1,000 bp simulation).
1 These modifications are read by the binding partner 'readers' at the level of a distinct or multiple modifications.
These diverse modifications are read out by effector protein complexes, which ultimately determine their functional outcome by modulating the activity state of underlying genes.
Modifications were read out by primer extension using an LNA-modified primer (5′-GAALCALCALAALTCLCTALAAA-3′) complementary to nucleotides 176 192.
The sites of increased or decreased NMIA and kethoxal modifications were read out by primer extension with a DNA primer, 5′TCACTGTGGCACTTTCAAGG, complementary to nucleotides 87−106, as described for chemical mapping.
If there were twice as many reads for modification A as for modification B, the percentages would still be directly comparable because modification A would have twice as many total reads along with twice as many telomere reads which would produce the same percentage or mapped reads.
Two procedures were used to detect editing sites: (A) 'weak' editing sites procedure: a binomial test was applied to find the significant modifications between RNA reads and the Swiss-Prot ORFs.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com