Sentence examples for modification reading from inspiring English sources

Exact(1)

Our studies support the general view that histone modification "reading" and DNA methylation are closely coupled in mammalian cells, and suggest an avenue for the functional assessment of chromatin-associated proteins.

Similar(59)

Read trimming, quality filtering, mapping, and conversion to per-gene counts was performed as described previously [ 27] with one modification: reads mapping to the same starting coordinate in the reference and aligning with 100% identity along the full length of the shorter read were discarded as potential PCR duplicates.

The choice of the cell viability assay using crystal violet staining was based on a previous work [ 32] with modification of reading A595 nm.

1 These modifications are read by the binding partner 'readers' at the level of a distinct or multiple modifications.

These diverse modifications are read out by effector protein complexes, which ultimately determine their functional outcome by modulating the activity state of underlying genes.

We did not observe significant 5' modifications from reads derived from miRNAs in either cells or exosomes.

Modifications were read out by primer extension using an LNA-modified primer (5′-GAALCALCALAALTCLCTALAAA-3′) complementary to nucleotides 176 192.

The sites of increased or decreased NMIA and kethoxal modifications were read out by primer extension with a DNA primer, 5′TCACTGTGGCACTTTCAAGG, complementary to nucleotides 87−106, as described for chemical mapping.

The activity of histone demethylases and their targeting to chromatin substrates appears to significantly rely on reading histone modification state and, in some instances, generic DNA-binding activities.

The most frequent functions are writing and reading histone modifications, and chromatin remodeling.

As most readers of Jacques Derrida know, when he altered the French word (différence) by substituting an a for the e différance"— he was producing a graphic modification ("it is read, or it is written, but it cannot be heard") in order to overcome the traditional metaphysical precedence of truth and presence over writing and difference.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: