Sentence examples for mode to check from inspiring English sources

Exact(3)

The campaign is bigger than ever with 4-player co-op, multiplayer features characters with special abilities, and there's an all new star-studded Zombie mode to check out.

For IL-10 the following primers were used with an annealing temperature of 56°C: forward 5'- AGGAGACGTTCGAGAAGATGGAT -3'; reverse 5'- TCACTTCCTCCTCCTCATCAGC-3'. The amplification and detection of specific products was performed on a 7300 Real Time PCR System (Applied Biosystems, Foster City, USA) using the dissociation curve mode to check the specificity of amplification products.

Realistic light-source ray tracing of the total system was performed in the non-sequential (NSC) mode to check light distributions at the hole mirror and at the eye.

Similar(57)

The energy minimized guest conformation is then subject to normal mode analysis to check whether the guest is in its local minimum conformation.

The air cooling mode and the water cooling mode were applied to check the effect on the adsorption system.

It visualizes the description of a transition and the assignment can be simply done by mouse-clicking on the diagram; moreover its display mode feature lets to check the experimental spectrum in which all the assigned lines together with their description are reported.

Ensure that 'Data mode 1' is set to 'Check Force raw reading and on errors and write uncorrected.

Batch mode is required for checking large BioPAX models, such as complete database exports, whereas library mode is typically used to check for correctness as a BioPAX model is being imported or manipulated by software tools.

The lawyer quickly realizes he messed up and morphs into damage control mode while Des goes to check on Ben.

We compute empirical P -value for each kind of evolutionary motif mode with specific topology to check the statistical significance of its enrichment or depletion in the real PIN (see Methods).

LES is also used to check modes predicted by an acoustic Helmholtz solver where the flow is frozen and flames are modelled using a Flame Transfer Function (FTF) as done in most present tools.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: