Sentence examples for mode check the from inspiring English sources

Suggestions(1)

Exact(1)

This filtering can be obtained by following these steps: (1º) having selected the entropy-based mode, check the option "Deselect All" on the list of descriptors; (2º) select from the list these three descriptors.

Similar(59)

Whenever you're standing in line, waiting at a red light, riding the elevator, walking to the subway: you have the choice to go into worker-bee mode (check your phone, make a mental shopping list, decide whether to stop at the dry cleaner, etc., etc). or take a deep breath and let yourself just be - and dream.

a Prototype, b robot is under driving mode, c the solenoid is electrified, and robot is under detecting mode and check the defect of the pipe, d after checking the area, the solenoid is set off, and the robot is back to driving mode again, e another operation cycle of detecting.

For IL-10 the following primers were used with an annealing temperature of 56°C: forward 5'- AGGAGACGTTCGAGAAGATGGAT -3'; reverse 5'- TCACTTCCTCCTCCTCATCAGC-3'. The amplification and detection of specific products was performed on a 7300 Real Time PCR System (Applied Biosystems, Foster City, USA) using the dissociation curve mode to check the specificity of amplification products.

If you are very secretive about the domain name, use Domometer in private mode and check the domain name quality grade.

Oh, and while you're in a listening/watching stuff mode, check out their mind-melting video for "Modern Art" here.

A smaller button is located on the backside that, when pressed, lights up the LCD display to change modes and check the life of the battery.

The platoon went into assessment mode, checking for injuries among the citizens.

The energy management system sets up the standby mode or sleep mode after checking the in short range or out of range.

In similarity query process, there are two situations needed to be carefully considered: the first is that if there exist "zooming in" or "zooming out" modes similar to the given mode when checking the time series, namely, similar to "zooming in" or "zooming out" mode, then it is an approximate proportional scaling of the length and magnitude to the given mode.

Using your map or the debug mode, check out the "Y" axis: this indicates your elevation.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: