Sentence examples similar to ml were amplified from inspiring English sources

Th remaining cells were amplified overnight in 200 mL of SB media supplemented with 50μG.mL−1 of carbenicillin.

Finally, phages were amplified in a 50-ml baffled flask (2YT-Amp-Kan) overnight.

The generated recombinant viruses were amplified to >10 viral particles per ml.

To generate stable shRNA c-Yes clones, pSilencer-Yes shRNA or sh-control Ambion construct (srb1) were transfected into HT29 cells and neomycin-resistant colonies were amplified (400 µg/ml).

Transformed BL-21 cells were amplified by growing on LB broth medium supplemented with 50 µg/ml kanamycin.

Asx exons were amplified using genomic PCR.

The basic ones were amplified with 5'gcctgctcgaattcgggatg3'/3'gtctgcctgcatctagagga5'.

Positive clones were amplified and sequenced.

No products were amplified in water.

All cDNA samples were amplified in duplicates.

Plasmids were amplified in DH5α strains.