Your English writing platform
Discover LudwigExact(1)
For experiments performed on the FAU Aibo corpus, the number of states and mixtures were picked based on a preliminary search and the results are discussed in Section 7.2.
Similar(59)
Samples were picked up from the mixture at regular times and subjected to centrifugation.
Ultrathin cryosections were picked up in a mixture of 50% sucrose and 50% methyl cellulose and incubated with anti-HA and anti-GFP and revealed with 10 nm and 15 nm protein A gold (Utrecht).
Ultrathin cryosections were picked up in a mixture of 50% sucrose and 50% methylcellulose and incubated with primary antibodies (ATG16L1, ATG9 and rabbit anti-mouse to recognize TfR) followed by protein A gold (Utrecht).
The sections were picked up using a 1+1 mixture of 2.3 M sucrose in PBS and 2% methyl cellulose in water and transferred onto Pioloform/carbon-coated grids.
In this paper, six chemicals belonging to three categories, two substituted phenols, two pesticides and two Ionic liquids, were picked to construct a six-component mixture system.
Over 600 colonies from discrete mixtures, representing about half of the complexity of the TEAS library, were picked and their sequences determined.
The ligation mixture was transformed into DH5α competent cells (Tiangen) and white colonies were picked and insertion was analyzed by PCR and restriction enzyme cleavage.
Positive colonies were picked with a toothpick, dipped into PCR reaction mixture with Taq DNA polymerase (ABgene) and PCR amplified using vector primers T7 (5' TAATACGACTCACTATAGGG 3') and SP6 (5' ATTTAGGTGACACTATAGAA 3').
After cryo-sectioning, sections were picked up and thawed according to Liou et al. [28] in a 1∶1 mixture of 2.3M sucrose and 2% (v/v) methylcellulose.
Colonies were picked and stocked.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com