Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
For the spectra of mevalonate 3,5-bisphosphate, the PEP concentration in the enzymatic reaction mixture was doubled to 40 mM to allow for full conversion of 20 mM (R -mevalonate to mevalonate 3,5-bisphosphate.
Similar(58)
To test the effect of sumoylation on activity, CBS (1 µg) was sumoylated as described above except that the amount of CBS and SUMO-1 in the assay mixture were doubled (to 16 pmole of CBS subunits and 20 pmol of SUMO-1) and incubated for 6 h at 37°C.
The potential medicinal effect of this mixture is doubled when it is taken on an empty stomach.
The mixture was double boiled in water bath for 30 min and filtered (Whatman Grade 4) after cooling.
After 24 h, the mixture was double boiled in a water bath for 30 min and after cooling was filtered through Whatman no. 4 filter paper.
The mixture was then double boiled in water bath for 30 min, cooled and then filtered (Whatman No. 4).
He's doubling down".
The mixture was diluted by double distilled deionized water in 50 mL volumetric flask.
The mixture was filtered through double-layered muslin cloth and the solid residue was neutralized with 1 N HCl.
The single-stranded DNA mixture was then made double-stranded by performing PCR amplification with Roche-454-FLX primers (CCATCTCATCCCTGCGTGTCCCATCTGTTCCCTCCCTGTCTCAG and CCTATCCCCTGTGTGCCTTGCCTATCCCCTGTTGCGTGTCTC).
The reaction mixture was added in double the volume of the media and was kept in dark for 45 min and then the reaction was stopped by adding 1/10 volume of 1 N HCl to each well.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com