Your English writing platform
Discover LudwigExact(10)
One hundred ng of total RNA were transcribed using SuperScript II RT and a mixture of oligo (dT) (100 ng/reaction) and random primers (200 ng/reaction; all from Invitrogen).
5 µg of RNA was pre-annealed to a 1∶1 mixture of oligo dT and random primers (0.32 µg/µL each) by incubation at 70°C for 10 min followed by 10 min on ice.
10 20 µg of RNA (same amount for every strain within a single experiment but different in different experiments) was pre-annealed to a 1∶1 mixture of oligo dT and random primers (0.32 µg/µL each) by incubation at 70°C for 10 min followed by 10 min on ice.
Reverse transcription was performed on 2 μg total RNA with the superscript III first-strand synthesis system for RT-PCR kit (Invitrogen) using a mixture of oligo (dT 20 and random hexamer primers.
First strand cDNA reactions from 5 μg total RNA were primed with a mixture of oligo d(T) and a cDNA primer (Tc-18S cDNA: AAGAAATATCGGTGAACTTTCG) specific to the 3' end of T. cruzi 18S rRNA.
The effect of the oligo dT priming in the RNA amplification was identified when the degraded RNA sample was amplified using a mixture of oligo dT primer and random primer.
Similar(50)
cDNA was prepared from total RNA using QuantiTect Reverse Transcription kit (Qiagen) using mixture of oligo-dT and random primers method.
As can be seen, the structure proposals include a mixture of oligo-mannose, complex and hybrid N-glycans (example MS/MS spectra available as ESM Fig. S5).
Following RNA isolation, 5 μg of total RNA was treated with DNase [DNase I, RNase free (Fermentas)] and reverse transcribed [RevertAid First Strand cDNA Kit (Fermentas)] using a 1 1 mixture of oligo-dT and random hexamer primers.
cDNA was generated in a reverse transcriptase reaction using 10 μg total RNA with a 1 1 mixture of oligo-dT and random hexamer primers (Operon) and a 2 3 ratio of amino-allyl-dUTP dTTP (Sigmamino-allyl-dUTP dTTP
RNA samples were labeled with either Cy3- or Cy5-labeled nucleotides (CyScribe first-strand cDNA labeling kit, Amersham Biosciences, Piscataway, NJ), using 10 μg of DNAse-treated RNA and a mixture of oligo-dT and 9-mer random oligonucleotides.
More suggestions(1)
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com