Sentence examples for mixing templates with from inspiring English sources

The experimental results demonstrate the possibility of forming long-range ordering of 6 and 9 self-assembled nanodot arrays with a size of 20 nm and a pitch of 33 nm between the guide lines, using the mixing templates with three and fourfold post lattices, respectively.

The assay involves only mixing template DNA with seven reagents and incubating at 64 °C for 80 min and does not require special or expensive equipment because detection is based on visual observation under natural light.

Polymerase chain reaction (PCR) of 16S rRNA gene was performed in 25  μL volume mixing the template DNA (10 ng) with 1x PCR buffer (Bioline), 2.5 mM MgCl2 (Bioline), 0.5 U Taq DNA polymerase (Bioline), 2.5 mM dNTPs each, 0.4  μM (each) primers fDl and rDl using a DNA thermal cycler (Applied Biosystems, USA).

Fast kinetic experiments were performed and analysed essentially as described (Yuzenkova et al, 2010), except for assembled EC13 were walked by one position by addition of 1-μM NTP specified by the template, before mixing them with 10 mM MgCl2 (final concentration) and NTPs (at concentrations specified in figures) in a Quench Flow regime.

To check the quality of each PCR run, we used negative controls (i.e., PCR mix without template) with every tenth sample, and we used 2 positive controls (R. felis DNA) per run.

The experiments were conducted using the Master SYBR Green reagent mixed with cDNA templates and corresponding primers, and the reactions were performed in a StepOnePlus machine (Applied Biosystems Inc., Carlsbad, CA, USA).

Primer sets (0.5 µM) were mixed with cDNA template and RT2 SYBR Green Master Mix (SABiosciences, Inc., Frederick, MD), and qRT-PCR was performed using an ABI Prism 7900 HT sequence detector as previously described [34].

20 pmol of split adapter/oligo dT primer (Integrated DNA Technologies) were mixed with the template RNA and dNTPs in 13 μl and heated to 70°C for 3 minutes in a thermocycler, cooled to 60°C then slow-ramped to 55°C over 2 minutes to anneal primer.

The templates were mixed with 7.5 µl master mix (containing 2.0 pmol of each primer set and 5.0 µl SYBR GREEN (Roche-04887352001), giving a total volume of 10 µl.

PCR was performed with 2 μl of template cDNA mixed with 18 μl of reaction mix containing 10 μl of 2× Master Mix Life Technologiess), 6 μl water, 1 μl of 10 μM forward primer (5′-ATG TCT GAA TAT ATT CGG GTA AC-3′) and 1 μl of 10 μM reverse primer (5′-GTC CAT CTA TCA TAT GTC GCT GTG-3′).

The first PCR was performed using 0.1 microgram of each ligation mix as a template with a primer AGCACTCTCCAGCCTCTCACCGAG using GeneTaq DNA polymerase (Nippon Gene, Japan).