Sentence examples for mixed and injected from inspiring English sources

Exact(18)

The labeled peptides were mixed and injected into the LC MS/MS system with a long monolithic silica capillary column for mass measurement and collected data were used for protein quantification.

The labeled peptides were mixed and injected into the LC-MS/MS system with a long monolithic column for mass measurement, and the data collected were used for protein quantification.

Equal volumes of cell suspensions for the two strains were mixed and injected into leaves of N. benthamiana.

The junctions between T21D12.3 and Venus were confirmed by sequencing with primers AGAAATTTCCACAACAAGAA and TCTGGACCCTGTGACGTCAT. pGEMT-T-T21D12.3-Venus (20 µg/ml) and pFX-RXT-myo-2 (20 µg/ml), a marker of pharyngeal muscle to distinguish transgenic worms, were mixed and injected into the germ line of adult worm, according to the method by Mello et al. [27].

Both target cells were mixed and injected into tumour-transplanted mice.

Peptides were coupled separately via the N-terminus and added cysteine residue respectively to BSA and keyhole-limpet haemocyanin, mixed and injected into sheep at Diagnostics Scotland.

Show more...

Similar(41)

80 g of Refobacin high-viscosity bone cement was vacuum-mixed and injected with a cement gun (Optivac; Biomet) in a retrograde manner, 2 min after the start of mixing.

Next, 100 mM N-hydroxysulfonyl succinimide (sulfo-NHS) (Pierce; Rockford, IL, USA) and 400 mM 1-ethyl-3- 3-dimethylaminopropyl) (EDC) (Pierce; Rockford, IL, USA) were mixed (1-ethyl-3- 3-dimethylaminopropylll 1-ethyl-3- 3-dimethylaminopropylmin 1-ethyl-3- 3-dimethylaminopropylon of the carboxyl group of 1-ethyl-3- 3-dimethylaminopropyl

The scintillating phosphor, supplied by Phosphor Technologies Ltd (2014) is mixed with an epoxy mix and injected into a cylindrical mould containing the exposed PMMA fibre optic core and allowed to cure.

Control (LMN-Cherry) and experimental (LMN-GFP) shRNA populations were mixed 1 1 and injected intravenously into recipient mice.

Imidacloprid normally is mixed with water and injected into the soil around the root system of a hemlock.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: