Sentence examples for mix were purchased from inspiring English sources

Tube stock of M. ericifolia (6 months old), grown in potting mix, were purchased from 'Go Native Landscapes Pty Ltd' (Inverloch, Victoria, 3996, Australia) grown from seeds collected from M. ericifolia stands at Dowd Morass wetland in Inverloch, Victoria, Australia.

Mouse Wnt Signaling Pathway RT2 Profiler PCR Array (http://www.superarray.com/rt_pcr_product/HTML/PAMM-043A.html) and RT2 Real-Timer SyBR Green/ROX PCR Mix were purchased from SuperArray Bioscience Corporation.

DNA repair primers and RT2 SYBR®Green master mix were purchased from SABiosciences (Frederick, MD) while common primers for both mouse and human AID were synthesized in-house (hmAID-F: CCAWTTCAAAAATGTCCGCTGGGC; hmAID-R: AGGAGGTGAACCAGGTGACGCG). Real-time PCR was run in a 384-well plate on an ABI Prism 7900HT RealTime System (Applied Biosystems, Foster City, CA).

AMV-RT and dNTP mix were purchased from Promega.

The TaqMan MGB probes and Mix were purchased from Applied Biosystems.

The primers, probes, and master mix were purchased from Applied Biosystems (Poster, CA).

Deoxyribonucleotide triphosphate (dNTP) mix was purchased from Epicentre (USA).

The soup mix was purchased from an independently owned one location institution of foodie-ism in Santa Monica, California, Bay Cities Italian Deli.

RT2 Real-Time™ SYBR Green/Fluorescein PCR Master Mix was purchased from SABiosciences (Gaithersburg, MD).

The SYBR green master mix was purchased from Applied Biosystems Inc.

SYBR Green PCR Master Mix was purchased from Applied Biosystems.