Sentence examples for mix was loaded from inspiring English sources
100 μL of this hybridization reaction mix was loaded in order D, W/D, Wa and Ws to each of the respective individual grids on the 44K oligo-array using Agilent's SureHyb enabled Hybridization reaction chamber and gasket slides.
The only thing missing from this volatile mix was loaded firearms and oily rags near open flames.
The mix was loaded on chromatography column (BIORAD) and washed with PBS.
The mix was loaded on a chromatography column (BIORAD), washed with PBS, 100mM KCl.
The mix was loaded on a chromatography column (BIORAD), washed 4 times with 5 mL PBS, 100mM KCl.
PCR master mix was loaded to each well and the plate centrifuged at 2,000 x g for 20 seconds and run on a 7900HT (ABI).
His hour-long mix is loaded with cuts from John Talabot, Clarian, David August, as well as one of his own remix beauties.
For fluorescence-based analysis of fragments, 5 μl of each PCR mix were loaded onto the ABI 310 DNA Analyser (Perkin-Elmer, Germany).
To evaluate MXI1 expression after transfection in U87 cells MXI1 cDNA was amplified for 35 cycles with primers MXI1-A1 and MXI1-R2b (CATGCTGGGTTCTATGAAGAG) 10/50 μl of PCR mix were loaded.
I used to add a couple of spoonfuls of sherry to make it seem homemade; now I use a little extra vanilla extract, or almond extract, or ground cardamom -- mysterious". Not all cake mixes are loaded with unhealthy ingredients.
Briefly, the hybridization mixes were loaded onto 4 × 44 K format slides (Agilent Birmingham D.rerio 025794 45220v1) hybridized overnight, washed, stabilized and dried.
