Sentence examples similar to mix split from inspiring English sources

Similar(60)

If the mix splits, add some breadcrumbs to bring it back together, then carry on adding the remaining eggs.

The results show that the mixing split vanes, which affect strongly the heat transfer in the sub-channel, are lateral flow, swirl and turbulent intensity between the sub-channels, and give reasonable agreements with experimental equations and AP1000 thermal hydraulic design.

The existing dilution algorithms attempt to reduce the number of mix-split steps required in the process but focus little on the minimization of sample requirement or waste droplets.

The principle of an OBOC combinatorial library is the synthesis of many compounds in solid-phase by a "Mix-Split" approach [9].

Today, the mix is split evenly between city and suburb.

Fake Blood's mix is split into two halves — The Club and The Afterparty.

This mix of split resources and early deaths has ensured that Labour's operation in Scotland is a B-team at best.

This helps maintain the overall energy of the mix evenly split over the stereo speakers and maximizes the dynamic use of the stereo channels.

A water parcel entering the network will mix and split at the fracture intersections and parts of the original parcel will traverse a multitude of different fractures.

An oligonucleotide was synthesized by "mix and split" procedure which contained the complete (G2W5 4 sequence repertoire flanked by constant regions (tagrep; CCTTAATTAATACGACTCACTATAG(G2W5 4CCCGGGGG).

This reaction mix was split into two equal portions, and to one half was added 12-fold competitor DNA containing 5-hmC but without a biotin tag.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: