Sentence examples for mix of forward from inspiring English sources
Told in a clever mix of forward motion and flashback, the Quayles' story evolves from their first meeting, at a lecture of his where she is an impassioned and out-of-control heckler, through their early marriage, their transfer to Kenya, her pregnancy and the beginnings of her journey of discovery about the evils of Big Pharma.
Five additional cycles were added when using primer cocktail C_tRWF_t1 (mix of forward primers given in Table 1).
(C) We stress that both quiet and active wakefulness involve a mix of forward, backward and dwelling locomotion, albeit with distinct proportions.
Each reaction volume consisted of 10 μl Sybr qPCR Mix, 0.4 μl 50 × ROX reference dye, 0.4 μl mix of forward and reverse primers (0.2 μM each) and 7.8 μl RNAase free water containing cDNA (17.5 ng).
Briefly, PCR was performed in a 20-μL volume of 2 μL 10× PCR buffer (Bioline Ltd, London, UK); 0.5 units Taq polymerase (Bioline Ltd); 0.5 μL 2 mmol dNTP mixture (Bioline Ltd); 0.5 μL 20-μmol mix of forward and reverse primers, 15.5 μL water, and 1 μL of crude DNA extract.
Briefly, the reaction mixture for HRMA included 3 μl sterile water, 4 μl LightScanner Master Mix (Idaho Technology, Salt Lake City, UT, USA), 1 μl LC green fluorescent dye, 0.2 μl 1 : 1 mix of forward and reverse primer (25 μ�� for EGFR and 10 μℳ for K-ras assays) and 2 μl of 15 ng μl−1 DNA sample.
The company didn't disclose the source of the funding, referring to the group as "a mix of forward-thinking market, tech, and social impact investors and investment funds".
Coming at you straight from the pulsating heart of London town, boy wonder Shox delivers "Just Let It," a rinsing mix of forward-thinking garage beats, spaced-out synths, and big, bad basslines.
Now, Anthony will play a mix of small forward and power forward.
AAD1 assay mix consisted of forward (AACCATGCAAGCCACCAT) and reverse (GGTAGAGGGAACCGAACACA) primer at a final concentration of 0.375 μM and UPL probe #53 at a final concentration of 0.1 μM with 1x Light Cycler480® Probes Master mix.
Reference assay mix consisted of forward (AGCCAAGCCAGTGGTACTTC) and reverse (TCGCAGACAAAGTAGCAAATGT) primer at a final concentration of 0.25 μM and UPL probe at a final concentration of 0.1 μM with 1x Light Cycler480® Probes Master mix.
