Sentence examples for mix load from inspiring English sources

This assessment also shows risks to workers who mix, load and apply chlorpyrifos pesticide products.

Impacts on energy efficiency and green house gas emissions (electricity mix, load management etc).

Workers "who mix, load and apply chlorpyrifos pesticide products," according to the analysis, face particular risks.

These individuals do not mix, load or apply 2,4-D, but may have the opportunity for indirect exposure over and above the general population.

The best way to ensure this is to mix loads of grit into the general area or container (50 50 grit to potting compost is none too gritty) they are to be planted in, or to add a good dollop of grit in every planting hole.

There are heavy 3D graphics or graphics and compute that mix loads.

Psychedelic LA beatsmith Computer Jay brings all that up in this personal throwback vision of dystopian future by means of a mix loaded with arpeggiated melodies, analog references, and fuzzy electronics.

β- actin was amplified for 25 cycles with primers ß-Act-F2, ACCAACTGGGACGACATGGA and β-Act-R2, GTGGTGGTGAAGCTGTAGC and 5/50 μl of PCR mix loaded together with MXI1 amplified from the same RNA.

The group of buildings feature homogenous parameters, like energy standards for buildings, functional mixes, load profiles for heat and cooling, defined in the university consortium, which serves as the guideline for development.

No longer are homemade music mixes loaded with significance; they do not take the hours of labor that a mix tape required.

About 20% reported some involvement in pesticide mixing, loading, or application.