Sentence examples for mismatch was introduced from inspiring English sources
The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand.
However, while the fully matched crHyb showed almost total cleavage of target DNA, when a single C > A mismatch was introduced the nuclease activity was almost completely ablated, with <4% activity detected (Fig. 2b).
The radius mismatch was introduced to composite the phase difference.
For SNP695872, Primer SCA2-NOTI (5'-ccttctccccctcgccagcccgggcgcccctccggccgcgccaacccgcg CCTCCCCGCTCGGCGGCCG-3', mismatch underlined) was used such that one mismatch was introduced to generate a recognition site for the restriction endonuclease NotI (recognition site 5'-GC'GGCCGC-3').
For SNP695871, Primer SCA2-AVAII (5'-ctcccggcggctccttggtctcggcggg CCTCCCCGCCCCTTCGTGGTC-3', mismatch underlined) was used such that one mismatch was introduced to generate a recognition site for the restriction endonuclease AvaII (recognition site 5'-G'G(A/T)CC-3').
When a single mismatch was introduced into each recognition site of the T2 target sequence (Fig. 7C; M2-1 and M2-2), the binary probe did not bind the target sequence (Fig. 7D), demonstrating single nucleotide discrimination.
On the other hand, because we have adopted a reduced form of cloaking design (equations (4,5)), a small impedance mismatch is introduced between the surrounding optical medium and the cloak, which results in a small amount of reflection at their interface.
Thus, here, a radius mismatch is introduced to provide unequal SPP wave propagating lengths for compositing the initial phase difference.
The video is played back locally or using a mechanism, where no additional jitter/synchronization mismatch is introduced.
In order to enhance reaction specificity, a deliberate mismatch is introduced at the penultimate base.
Three nucleotides mismatch were introduced between positions 10 and 11 from the miRNA seed sequences to prevent AGO2-mediated mRNA cleavage and therefore trigger miRNA decoy effects.
