Sentence examples for mismatch in primer from inspiring English sources

(2) exact barcode matching, two nucleotide mismatch in primer matching, reads containing ambiguous characters were removed.

Quality trimming criteria included no mismatch in MID sequences and a maximum of 1 mismatch in primer sequences.

While no sequence mismatch in primers and probe was found among the 7 NoV GI isolates, 5 of the 36 GII isolates had a single mismatch.

Reads were removed if they were: (1) shorter than 75 bp, (2) longer than 115 bp, or (3) contained any mismatch in primers.

Results showed that for multiple mismatches (up to 3 mismatches) in primer regions where mismatches were previously considered tolerable (middle and 5′ end), quantification accuracies could be as low as ~ 0.1%.

Addition of engineered mismatches in primer sequences can allow detection of SNPs that do not condition restriction polymorphisms [ 4].

First, a ratio (log2 differences) was calculated based on the number of molecules measured with primers containing mismatches (one mismatch in one primer or in both primers) over that obtained with perfect match primer pairs (Table 1).

The voluntary introduction of mismatches in primers is commonly used in combination with 3' end single nucleotide polymorphism during amplification refractory mutation system (ARMS-PCR) with the clear objective of destabilizing primer annealing [ 23].

4 not determined Since mismatches in primers cause a shift in amplification profiles we calculated the differences between quantification cycles (Cq) generated by reactions containing primers with mismatches to the average Cq obtained with perfect match primers (ΔCq method; see Additional file 1).

Sequences that met the following parameters were kept for analysis: (1) length between 264 and 324 nucleotides for the conventional mice data set, and between 510 and 570 for the conventionalized mice data set; (2) no ambiguous bases; (3) quality score equal or above 25; (4) no mismatches in primers; and (5) no mismatches in barcodes.

10 A PPAD oligonucleotide with a point mutation at the Cys codon at position 351 in PPAD replacing Cys with Ala was designed using the 5′ and 3′ ultrapure primer pair (HYPUR-grade from MWG Eurofins)—atgccctgcat gcccgtactcacgag and ctgttcctaaccaaggtgttcctgaag, respectively with 5′-phosphorylation (mismatch in forward primer creating point mutation is underlined).