Sentence examples for mismatch control from inspiring English sources

Exact(60)

Mice were randomized into three groups (n = 15 mice): no treatment (PBS), 2′F/MOE anti-miR-33 (TGCAATGCAACTACAATGCAC) oligonucleotide, and 2′F/MOE mismatch control (TCCAATCCAACTTCAATCATC) oligonucleotide (the mismatched bases are underlined).

The main challenges to design an effective computation offloading algorithm lies in the adaptive division of applications for partial offloading, the mismatch control mechanism between how individual mobile devices demand and access computing resources, and how cloud providers offer them.

1) We used mismatch control morpholinos in the embryo phenotype experiments to control for the morpholino sequence, save 5 nucleotides.

Co-injecting hjv MO1 and hjv MO2 exacerbated notochord distortion (Figure 2D), however injection of a mismatch control morpholino (hjv MMO2) did not distort the notochord (Figure 2E).

For in vivo treatment experiments, imetelstat or mismatch control oligonucleotide (30 mg/kg) was injected intraperitoneally three times a week for two weeks.

However, co-injection with MO1 totally suppressed the YFP expression; in contrast, the mismatch control, 5mmMO1, did not affect the YFP expression (Fig. S3B).

A 5 mismatch control morpholino (CO) has minor effects on FN assembly that are not significant enough to block gastrulation (Figure 4B, E).

None of the morpholino injections significantly changed the mean bundle length when compared to that of animals injected with 5-bp mismatch control morpholinos (data not shown).

We treated NCI-H929 cells with imetelstat or mismatch control for two weeks in vitro and subsequently injected them intravenously into NOD/SCID mice.

The MO sequences were as follows: zLMNA-MO1, 5'-CATGGTTGTCTGGAACTACTGATA-3'; zLMNA-MO2, 5'-ACATACAGTACACACCTGTCTGGGT-3'; zLMNA-MO2.1; 5'-ACACATACAGTACACACCTGTCTGG-3'; 5-base mismatch control for zLMNA-MO1 (MO1-5-mis), 5'-CATGcTTcTgTGcAACTACTcATA-3' (mispairing bases are indicated in lowercase); 5-base mismatch control for zLMNA-MO2 (MO2-5-mis), 5'-ACATAgAcTACAgACCTcTCTcGGT-3'.

We used the GC-RMA (Robust Multi-array Analysis) method to normalize the hybridisation results; this method uses the GC content of the probes to reduce variance in the mismatch (control) probe levels as spotted on the Affymetrix arrays [10].

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: