Sentence examples for minute denaturation step from inspiring English sources

For the 1401 bacterial primer set (f968-GC and R1401a/b) an initial 5 minute 95.0°C denaturation step was followed by 35 total cycles, each cycle initiated by a 1 minute denaturation step at 95.0°C.

For the 23 s primer set (p23SrV_f1 and p23SrV_r1), PCR conditions included an initial 5 minute denaturation step at 94.0°C, followed by 35 cycles each consisting of denaturation at 94.0°C for 20 seconds, annealing at 55.0°C for 30 seconds and extension at 72.0°C for 30 seconds.

Briefly, reverse transcription was carried out with the Expand Reverse Transcriptase (Roche, Mannheim, Germany) for 30 min at 42°C with primers F1 Forward primer GTTGGATCTGCAATCGCCAGTGGC and F2 Reverse primer GTACATAGAGGGGATGTGTG, followed by a five minute denaturation step at 99°C.

For both MHB and PAL LTER samples, amplification conditions described in Sogin et al., 2006 [4] were modified as follows: the initial 94° C, 3 minute denaturation step was followed by 30 cycles of 94°C for 30 s, 57°C for 60 s, and 72° for 90 s before a final 10 minute extension at 72°C.

PCR amplification involved an initial 2 minute denaturation step at 94°C and extension at 72°C for 30 seconds.

Following amplification (and a one minute denaturation step at 95°C and 2 minutes at 55°C) melting curve analysis of 20 reads/°C from 55-75°C 55-75°C

The cycling conditions were a 3-minute denaturation step at 94°C followed by 35 cycles at 92°C for 30 sec, 55°C for 30 sec and 68°C for 2.5 minutes with a final extension step at 68°C for 5 minutes.

For experiments shown in Fig. 2B E, ligation was performed in solution with single hexamer oligonucleotides. 1 pmol of hexamers, 4 units of T4 DNA ligase and 2 µl 5× DNA Ligase buffer (In vitrogen - Life Technologies, Breda, NL) and template/annealer complex were added in a total volume of 10 µl and incubated for 45 minutes at 16°C, followed by a 10 minutes denaturation step at 65°C.

qPCR amplifications were performed with 10 ng of DNA on a Rotorgene 6000 apparatus (Qiagen, Courtaboeuf, France) using ABsolute Blue qPCR SYBR Green Mix (ref AB-4167; ThermoFiScientifictIllkirchlkirch, France) with an initial 15-minute denaturation step at 95°C followed by 40 cycles.

A 5 minutes denaturation step was followed by 34 cycles of denaturation at 94°C (30 sec), annealing at 59°C (30 sec) and extension at 72°C (1 min); the final extension step was carried out at 72°C for 5 minutes.

The cycling and melting conditions are shown in Additional file 3: Supplementary table 2. All reactions had initial UDG treatment for FFPE artefacts at 37°C for 30 minutes [ 41], followed by an incubation step at 95°C for 15 minutes, denaturation step at 95°C, annealing steps at the temperatures listed in Additional file 3: Supplementary table 2, and an elongation step at 72°C.